tehA Gene Page
Genbank name: tehA
EcoGene name: tehA
Divergent gene: ydcK
Species with an ortholog:
EC HI ST
EcoGene link: EG11883
Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 17.79
Model logo: tehA.1.model.LGO.gif
Sequence logo: tehA.1.LGO.gif
Sequence Alignment: tehA.1.ALGN
Solution location in genomic coordinates: 1498540-1498558
Solution sequence with flanking nucleotides: gagaa AATTCCATAAAATGCATTT caaat
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1498560-1498578
Solution sequence with flanking nucleotides: atttc AAATATACTTTATAAATTA aacaa
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 14.18
Model logo: tehA.2.model.LGO.gif
Sequence logo: tehA.2.LGO.gif
Sequence Alignment: tehA.2.ALGN
Solution location in genomic coordinates: 1498548-1498570
Solution sequence with flanking nucleotides: tccat AAAATGCATTTCAAATATACTTT ataaa
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC HI ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 9.66
Model logo: tehA.3.model.LGO.gif
Sequence logo: tehA.3.LGO.gif
Sequence Alignment: tehA.3.ALGN
Solution location in genomic coordinates: 1498495-1498512
Solution sequence with flanking nucleotides: tgact TACTATAACCGTAGCAAA ttctg
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page