tesB Gene Page
Genbank name: tesB
EcoGene name: tesB
Divergent gene: ybaY
Species with an ortholog:
AA EC HI PA SP ST VC YP
EcoGene link: EG10995
Species that contributed to the solution: AA EC HI SP ST YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 9.28
Model logo: tesB.1.model.LGO.gif
Sequence logo: tesB.1.LGO.gif
Sequence Alignment: tesB.1.ALGN
Solution location in genomic coordinates: 474525-474545 R
Solution sequence with flanking nucleotides: agtgg TTAACAAAATAGTAACGTCAA caagt
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: AA EC HI ST VC YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 2
Map value: 9.19
Model logo: tesB.2.model.LGO.gif
Sequence logo: tesB.2.LGO.gif
Sequence Alignment: tesB.2.ALGN
Solution location in genomic coordinates: 474581-474601 R
Solution sequence with flanking nucleotides: t CATTTCTCCTTATTATCAATG cacca
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 474484-474504 R
Solution sequence with flanking nucleotides: tcacg CATTTCTGCCTGTAATTAGCC cgtaa
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: AA EC HI SP ST VC
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 2
Map value: 7.92
Model logo: tesB.3.model.LGO.gif
Sequence logo: tesB.3.LGO.gif
Sequence Alignment: tesB.3.ALGN
Solution location in genomic coordinates: 474534-474554 R
Solution sequence with flanking nucleotides: cgccg GAAGAGTGGTTAACAAAATAG taacg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 474428-474448 R
Solution sequence with flanking nucleotides: agtag CAAATTTGCGTTATACTCAAC tcact
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page