ubiC Gene Page

Genbank name: ubiC
EcoGene name: ubiC
Divergent gene:
Species with an ortholog: EC ST
EcoGene link: EG11369

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 0.98
Model logo: ubiC.1.model.LGO.gif
Sequence logo: ubiC.1.LGO.gif
Sequence Alignment: ubiC.1.ALGN
Solution location in genomic coordinates: 4249919-4249938
Solution sequence with flanking nucleotides: gttgc CCTCGCCAGCACGGGCATCG gtaaa
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: -1.15
Model logo: ubiC.2.model.LGO.gif
Sequence logo: ubiC.2.LGO.gif
Sequence Alignment: ubiC.2.ALGN
Solution location in genomic coordinates: 4249944-4249967
Solution sequence with flanking nucleotides: gtaaa GCGTAAGGTTCAACATCGTTTTAC cactt
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page