ubiE Gene Page

Genbank name: ubiE
EcoGene name: ubiE
Divergent gene:
Species with an ortholog: EC PA SP ST TF VC YP
EcoGene link: EG11473

Species that contributed to the solution: EC PA ST TF YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 13.31
Model logo: ubiE.1.model.LGO.gif
Sequence logo: ubiE.1.LGO.gif
Sequence Alignment: ubiE.1.ALGN
Solution location in genomic coordinates: 4016420-4016436
Solution sequence with flanking nucleotides: acaat TTTTTGATGAGCAGGCA ttgag
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 9.68
Model logo: ubiE.2.model.LGO.gif
Sequence logo: ubiE.2.LGO.gif
Sequence Alignment: ubiE.2.ALGN
Solution location in genomic coordinates: 4016357-4016380
Solution sequence with flanking nucleotides: ttggg AGTAGTTAAGCCGGGTAGAAATCT agggc
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 4016396-4016419
Solution sequence with flanking nucleotides: cgccc AATCTGTTACACTTCTGGAACAAT ttttt
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page