uxuA Gene Page
Genbank name: uxuA
EcoGene name: uxuA
Divergent gene: gntP
Species with an ortholog:
AA EC HI ST YP
EcoGene link: EG11066
Reported site,genomic coordinates and site type: DPInteract 4549019:4549040 crp
Species that contributed to the solution: EC HI ST YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 2
Map value: 13.85
Model logo: uxuA.1.model.LGO.gif
Sequence logo: uxuA.1.LGO.gif
Sequence Alignment: uxuA.1.ALGN
Solution location in genomic coordinates: 4548920-4548935
Solution sequence with flanking nucleotides: atgta AATTGGTCAACCATTG ttgcg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 4549026-4549041
Solution sequence with flanking nucleotides: ttgtg ATGTGGTTAACCAATT tcaga
Number of overlapping basepairs with reported site: 15
Site type: crp
Species that contributed to the solution: AA EC HI
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 7.81
Model logo: uxuA.2.model.LGO.gif
Sequence logo: uxuA.2.LGO.gif
Sequence Alignment: uxuA.2.ALGN
Solution location in genomic coordinates: 4548982-4549000
Solution sequence with flanking nucleotides: accct TTGCTGCAATTTGCAGCAA caacc
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: gntP_uxuA_IR     Overlap: 19
Species that contributed to the solution: AA EC HI
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 7.72
Model logo: uxuA.3.model.LGO.gif
Sequence logo: uxuA.3.LGO.gif
Sequence Alignment: uxuA.3.ALGN
Solution location in genomic coordinates: 4548958-4548977
Solution sequence with flanking nucleotides: tcctc TGATCAATAACCATCGATTA ccctt
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page