xthA Gene Page

Solution location in genomic coordinates: 1830275-1830291
Solution sequence with flanking nucleotides: tgacg AAATTTACTGGAAATTA ctgcg
Number of overlapping basepairs with reported site: 0
Site type:

---

Species that contributed to the solution: EC HI ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 6.67
Model logo: xthA.2.model.LGO.gif
Sequence logo: xthA.2.LGO.gif
Sequence Alignment: xthA.2.ALGN
Solution location in genomic coordinates: 1830069-1830092
Solution sequence with flanking nucleotides: gctgt AAATGTAGATTGCAGGGTTCGTGC cagcc
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1830316-1830339
Solution sequence with flanking nucleotides: cgcgc ACCAAAAGCGGGCATTTTTTGCGC catcg
Number of overlapping basepairs with reported site: 0
Site type:

---

Species that contributed to the solution: EC HI PA SP ST VC YP
Total number of sites in the solution: 9
Number of E. coli sites in the solution: 2
Map value: 6.37
Model logo: xthA.3.model.LGO.gif
Sequence logo: xthA.3.LGO.gif
Sequence Alignment: xthA.3.ALGN
Solution location in genomic coordinates: 1830130-1830150
Solution sequence with flanking nucleotides: gctaa CTGGAAATCAAGGAGTTATAA ccaaa
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1830218-1830238
Solution sequence with flanking nucleotides: agaat AAAAAACGCAATGTTATGCAG aagta
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page