yacE Gene Page
Genbank name: yacE
EcoGene name: yacE
Divergent gene: guaC
Species with an ortholog:
AA EC HI PA SP ST TF VC YP
EcoGene link: EG12312
Species that contributed to the solution: AA EC ST
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 13.23
Model logo: yacE.1.model.LGO.gif
Sequence logo: yacE.1.LGO.gif
Sequence Alignment: yacE.1.ALGN
Solution location in genomic coordinates: 113296-113319 R
Solution sequence with flanking nucleotides: ataaa TTTACCTGGTAAATAGTGAGCGAA cgttt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 113239-113262 R
Solution sequence with flanking nucleotides: cattt TTAACGTTTTGATAATCATGATGA attcc
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC SP ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 12.39
Model logo: yacE.2.model.LGO.gif
Sequence logo: yacE.2.LGO.gif
Sequence Alignment: yacE.2.ALGN
Solution location in genomic coordinates: 113414-113436 R
Solution sequence with flanking nucleotides: gcgga TTCCTGGGGTTAATGGCTATAAG ggtaa
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 113320-113342 R
Solution sequence with flanking nucleotides: gtctt TTTTTACGCTACAATCCCATAAA tttac
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: AA EC HI PA SP ST TF VC YP
Total number of sites in the solution: 11
Number of E. coli sites in the solution: 1
Map value: 11.17
Model logo: yacE.3.model.LGO.gif
Sequence logo: yacE.3.LGO.gif
Sequence Alignment: yacE.3.ALGN
Solution location in genomic coordinates: 113366-113381 R
Solution sequence with flanking nucleotides: tcata CGCACTAATCAATGCG gcgca
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page