yagU Gene Page

Genbank name: yagU
EcoGene name: yagU
Divergent gene: yagT
Species with an ortholog: AA   EC  
EcoGene link: EG13560
Solution location in genomic coordinates: 302169-302188
Solution sequence with flanking nucleotides: tatga ATACTCCTGAAGAGGTGTAT aacat
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 1.51
Model logo: yagU.2.model.LGO.gif
Sequence logo: yagU.2.LGO.gif
Sequence Alignment: yagU.2.ALGN
Solution location in genomic coordinates: 301811-301830
Solution sequence with flanking nucleotides: tccgg TATTCTAAAGGGGAAAATAA gagtg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 301856-301875
Solution sequence with flanking nucleotides: gatgc TTTTTTAAACGTTAAGCATA gtcgg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 1.03
Model logo: yagU.3.model.LGO.gif
Sequence logo: yagU.3.LGO.gif
Sequence Alignment: yagU.3.ALGN
Solution location in genomic coordinates: 302118-302139
Solution sequence with flanking nucleotides: gaaac TATCTTGTTATACAAAACAATA cagtt
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page