yahO Gene Page
Genbank name: yahO
EcoGene name: yahO
Divergent gene: yahN
Species with an ortholog:
EC ST
EcoGene link: EG13599
Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 4.04
Model logo: yahO.1.model.LGO.gif
Sequence logo: yahO.1.LGO.gif
Sequence Alignment: yahO.1.ALGN
Solution location in genomic coordinates: 345639-345657
Solution sequence with flanking nucleotides: ctgac TGAACTAATTATTAATCAA cccaa
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 3.65
Model logo: yahO.2.model.LGO.gif
Sequence logo: yahO.2.LGO.gif
Sequence Alignment: yahO.2.ALGN
Solution location in genomic coordinates: 345582-345601
Solution sequence with flanking nucleotides: aatcg GGTGCGAGAGAGATCACAAA gtgtc
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 345674-345693
Solution sequence with flanking nucleotides: gggtg GGTGATAGTGTGATAACAAC tctgg
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page