ybbA Gene Page

Solution location in genomic coordinates: 518865-518888
Solution sequence with flanking nucleotides: acatt CGATACCCGGCGCTCAGGCTATCA cccag
Number of overlapping basepairs with reported site: 0
Site type:

---

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 18.00
Model logo: ybbA.2.model.LGO.gif
Sequence logo: ybbA.2.LGO.gif
Sequence Alignment: ybbA.2.ALGN
Solution location in genomic coordinates: 518769-518787
Solution sequence with flanking nucleotides: cttgt TGCGAGGTGTCGCCGCTGA tgctg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 518907-518925
Solution sequence with flanking nucleotides: acgtg TCCGCTGCGGCGGCACGGA aggtt
Number of overlapping basepairs with reported site: 0
Site type:

---

Species that contributed to the solution: EC SP ST YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 2
Map value: 17.35
Model logo: ybbA.3.model.LGO.gif
Sequence logo: ybbA.3.LGO.gif
Sequence Alignment: ybbA.3.ALGN
Solution location in genomic coordinates: 518558-518580
Solution sequence with flanking nucleotides: gcttc ATTATAACGGCGACCATAGTTTG caggc
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 518675-518697
Solution sequence with flanking nucleotides: ggctg AAAACCACGCAAACCGTCATTGC cgccc
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page