ybbQ Gene Page

Genbank name: ybbQ
EcoGene name: ybbQ
Divergent gene:
Species with an ortholog: EC PA ST
EcoGene link: EG13265

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 5.47
Model logo: ybbQ.1.model.LGO.gif
Sequence logo: ybbQ.1.LGO.gif
Sequence Alignment: ybbQ.1.ALGN
Solution location in genomic coordinates: 535766-535786
Solution sequence with flanking nucleotides: gatcg TGTTGTCTGAATTCAGGAAAA gcgaa
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 3.71
Model logo: ybbQ.2.model.LGO.gif
Sequence logo: ybbQ.2.LGO.gif
Sequence Alignment: ybbQ.2.ALGN
Solution location in genomic coordinates: 535743-535762
Solution sequence with flanking nucleotides: tttag GCCGCTAAGTTGGCAGGGGA tcgtg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 3.15
Model logo: ybbQ.3.model.LGO.gif
Sequence logo: ybbQ.3.LGO.gif
Sequence Alignment: ybbQ.3.ALGN
Solution location in genomic coordinates: 535792-535809
Solution sequence with flanking nucleotides: gcgaa ATTTAAAAGAGGTTAATT
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page