ybgC Gene Page

Genbank name: ybgC
EcoGene name: ybgC
Divergent gene:
Species with an ortholog: AA   EC   HI   PA   SP   ST   TF   VC   YP   
EcoGene link: EG11110

Species that contributed to the solution: AA EC ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 13.93
Model logo: ybgC.1.model.LGO.gif
Sequence logo: ybgC.1.LGO.gif
Sequence Alignment: ybgC.1.ALGN
Solution location in genomic coordinates: 773956-773972
Solution sequence with flanking nucleotides: tttgt TGCATTACCGGGATGTA aa
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC PA SP ST VC YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 1
Map value: 13.24
Model logo: ybgC.2.model.LGO.gif
Sequence logo: ybgC.2.LGO.gif
Sequence Alignment: ybgC.2.ALGN
Solution location in genomic coordinates: 773848-773869
Solution sequence with flanking nucleotides: aaaat TATGGGCCGCTCCAGGCCCATA aattt
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: ybgE_ybgC_IR     Overlap: 22

Species that contributed to the solution: EC HI PA ST TF
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 7.77
Model logo: ybgC.3.model.LGO.gif
Sequence logo: ybgC.3.LGO.gif
Sequence Alignment: ybgC.3.ALGN
Solution location in genomic coordinates: 773918-773934
Solution sequence with flanking nucleotides: tcgcg CGCGTATAGTAGCAGCG tttaa
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page