ybjD Gene Page

Genbank name: ybjD
EcoGene name: ybjD
Divergent gene: aqpZ
Species with an ortholog: EC   ST   VC   YP   
EcoGene link: EG13425

Species that contributed to the solution: EC VC YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 9.04
Model logo: ybjD.1.model.LGO.gif
Sequence logo: ybjD.1.LGO.gif
Sequence Alignment: ybjD.1.ALGN
Solution location in genomic coordinates: 915587-915608
Solution sequence with flanking nucleotides: tcgct CATTTTTCAGACATTTGCCATG cttaa
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST VC
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 8.56
Model logo: ybjD.2.model.LGO.gif
Sequence logo: ybjD.2.LGO.gif
Sequence Alignment: ybjD.2.ALGN
Solution location in genomic coordinates: 915382-915398
Solution sequence with flanking nucleotides: cgagt CATTCACCAGATAAATA aatcc
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 915587-915603
Solution sequence with flanking nucleotides: tcgct CATTTTTCAGACATTTG ccatg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST VC YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 8.45
Model logo: ybjD.3.model.LGO.gif
Sequence logo: ybjD.3.LGO.gif
Sequence Alignment: ybjD.3.ALGN
Solution location in genomic coordinates: 915483-915506
Solution sequence with flanking nucleotides: aagat TTAATCCTTTAGGCGTAATAAAAA ataat
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 915644-915667
Solution sequence with flanking nucleotides: ggcct TTCCCGTTATACTGCCAGCGTAAA ggata
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page