yccA Gene Page
Genbank name: yccA
EcoGene name: yccA
Divergent gene:
Species with an ortholog:
EC HI PA SP ST TF VC
EcoGene link: EG11113
Species that contributed to the solution: EC HI PA ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 11.62
Model logo: yccA.1.model.LGO.gif
Sequence logo: yccA.1.LGO.gif
Sequence Alignment: yccA.1.ALGN
Solution location in genomic coordinates: 1030652-1030671 R
Solution sequence with flanking nucleotides: cttaa TTAATTACATCTGTCATAGA gagtg
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST VC
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 8.80
Model logo: yccA.2.model.LGO.gif
Sequence logo: yccA.2.LGO.gif
Sequence Alignment: yccA.2.ALGN
Solution location in genomic coordinates: 1030748-1030770 R
Solution sequence with flanking nucleotides: tgctt AATGACCTGATAATCCGCTGTTA aacct
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1030702-1030724 R
Solution sequence with flanking nucleotides: tgcgt AAAGATGGGTAAAACTTCTGGGT gccct
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC HI PA SP TF VC
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 1
Map value: 8.62
Model logo: yccA.3.model.LGO.gif
Sequence logo: yccA.3.LGO.gif
Sequence Alignment: yccA.3.ALGN
Solution location in genomic coordinates: 1030775-1030795 R
Solution sequence with flanking nucleotides: gtcga AATTCTCAGGGCGTTATATTT gctta
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page