ycdZ Gene Page

Genbank name: ycdZ
EcoGene name: ycdZ
Divergent gene:
Species with an ortholog: EC   ST   VC   
EcoGene link: EG13872

Species that contributed to the solution: EC ST VC
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 14.96
Model logo: ycdZ.1.model.LGO.gif
Sequence logo: ycdZ.1.LGO.gif
Sequence Alignment: ycdZ.1.ALGN
Solution location in genomic coordinates: 1099416-1099437
Solution sequence with flanking nucleotides: t AAGTGTGATCTACGTCACTCAT aactg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 13.88
Model logo: ycdZ.2.model.LGO.gif
Sequence logo: ycdZ.2.LGO.gif
Sequence Alignment: ycdZ.2.ALGN
Solution location in genomic coordinates: 1099441-1099464
Solution sequence with flanking nucleotides: ataac TGCAACGGATAATTTGTTGTTGCA taaaa
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page