ycgN Gene Page

Genbank name: ycgN
EcoGene name: ycgN
Divergent gene:
Species with an ortholog: AA EC HI PA SP ST VC YP
EcoGene link: EG13895

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 11.04
Model logo: ycgN.1.model.LGO.gif
Sequence logo: ycgN.1.LGO.gif
Sequence Alignment: ycgN.1.ALGN
Solution location in genomic coordinates: 1227992-1228011
Solution sequence with flanking nucleotides: gcaaa ACTTGCATCGCTGTGCCAGA ctggt
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: ycgM_ycgN_IR Overlap: 1

Species that contributed to the solution: AA EC HI PA VC
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 6.01
Model logo: ycgN.2.model.LGO.gif
Sequence logo: ycgN.2.LGO.gif
Sequence Alignment: ycgN.2.ALGN
Solution location in genomic coordinates: 1227967-1227988
Solution sequence with flanking nucleotides: tactt TTTGCCGCCTGAAAGCGGCGGC aaaac
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: ycgM_ycgN_IR Overlap: 22

Gene Index Page