ychM Gene Page

Genbank name: ychM
EcoGene name: ychM
Divergent gene:
Species with an ortholog: AA   EC   PA   SP   ST   VC   YP   
EcoGene link: EG12392

Species that contributed to the solution: EC SP ST YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 14.90
Model logo: ychM.1.model.LGO.gif
Sequence logo: ychM.1.LGO.gif
Sequence Alignment: ychM.1.ALGN
Solution location in genomic coordinates: 1260083-1260106 R
Solution sequence with flanking nucleotides: gtctg TAATATCCATTTGTATGACCTATG cctcc
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1260052-1260075 R
Solution sequence with flanking nucleotides: tcctt CACCTGCCATTTAGTTGACAGATG atgcg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC SP ST VC
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 14.62
Model logo: ychM.2.model.LGO.gif
Sequence logo: ychM.2.LGO.gif
Sequence Alignment: ychM.2.ALGN
Solution location in genomic coordinates: 1260006-1260025 R
Solution sequence with flanking nucleotides: tattg TGAACAAAATATTTTCCTCA catgt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC PA SP ST VC
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 14.46
Model logo: ychM.3.model.LGO.gif
Sequence logo: ychM.3.LGO.gif
Sequence Alignment: ychM.3.ALGN
Solution location in genomic coordinates: 1260114-1260137 R
Solution sequence with flanking nucleotides: ggctc AAAGACCCGCTGCGGCGGGTTTTT ttgtc
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: TERM20     Overlap: 24


Gene Index Page