ycjX Gene Page
Genbank name: ycjX
EcoGene name: ycjX
Divergent gene: ycjW
Species with an ortholog:
AA EC HI SP ST VC YP
EcoGene link: EG13921
Species that contributed to the solution: AA EC HI SP ST VC YP
Total number of sites in the solution: 9
Number of E. coli sites in the solution: 1
Map value: 9.77
Model logo: ycjX.1.model.LGO.gif
Sequence logo: ycjX.1.LGO.gif
Sequence Alignment: ycjX.1.ALGN
Solution location in genomic coordinates: 1382053-1382075
Solution sequence with flanking nucleotides: aacac GGGCAGTTGATAATCAATGGCCT ggccc
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: AA EC HI SP ST VC YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 1
Map value: 4.92
Model logo: ycjX.2.model.LGO.gif
Sequence logo: ycjX.2.LGO.gif
Sequence Alignment: ycjX.2.ALGN
Solution location in genomic coordinates: 1382088-1382109
Solution sequence with flanking nucleotides: acatt CATATCCTTACGAATGATTTTT tttct
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: AA EC HI SP YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 4.24
Model logo: ycjX.3.model.LGO.gif
Sequence logo: ycjX.3.LGO.gif
Sequence Alignment: ycjX.3.ALGN
Solution location in genomic coordinates: 1382031-1382052
Solution sequence with flanking nucleotides: atgga GTTCGCCGGTCGATGACAACAC gggca
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page