ydhC Gene Page

Genbank name: ydhC
EcoGene name: ydhC
Divergent gene: ydhB
Species with an ortholog: EC   PA   SP   ST   VC   YP   
EcoGene link: EG12141

Species that contributed to the solution: EC SP ST VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 22.87
Model logo: ydhC.1.model.LGO.gif
Sequence logo: ydhC.1.LGO.gif
Sequence Alignment: ydhC.1.ALGN
Solution location in genomic coordinates: 1737827-1737849
Solution sequence with flanking nucleotides: agtc TGCCTGCAAAATTTTTGAAACCA gtcat
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC SP ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 21.46
Model logo: ydhC.2.model.LGO.gif
Sequence logo: ydhC.2.LGO.gif
Sequence Alignment: ydhC.2.ALGN
Solution location in genomic coordinates: 1737855-1737870
Solution sequence with flanking nucleotides: gtcat CAAATATTACCGTTTC acaac
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST VC
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 5.98
Model logo: ydhC.3.model.LGO.gif
Sequence logo: ydhC.3.LGO.gif
Sequence Alignment: ydhC.3.ALGN
Solution location in genomic coordinates: 1737874-1737892
Solution sequence with flanking nucleotides: tcaca ACACTAATTTCACTCCCTA cactt
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page