ydiA Gene Page

Solution location in genomic coordinates: 1785366-1785387
Solution sequence with flanking nucleotides: aaata AAATTGAAGGTTCATTTTATAA accag
Number of overlapping basepairs with reported site: 0
Site type:

---

Species that contributed to the solution: EC SP ST VC YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 2
Map value: 15.74
Model logo: ydiA.2.model.LGO.gif
Sequence logo: ydiA.2.LGO.gif
Sequence Alignment: ydiA.2.ALGN
Solution location in genomic coordinates: 1785236-1785255
Solution sequence with flanking nucleotides: gttca AGCAAATATATTTTTTTACT tttta
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1785433-1785452
Solution sequence with flanking nucleotides: atgct TTCATAGAATTATGTCTGCA tcacg
Number of overlapping basepairs with reported site: 0
Site type:

---

Species that contributed to the solution: EC SP ST YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 14.11
Model logo: ydiA.3.model.LGO.gif
Sequence logo: ydiA.3.LGO.gif
Sequence Alignment: ydiA.3.ALGN
Solution location in genomic coordinates: 1785143-1785163
Solution sequence with flanking nucleotides: gaaca ATCCTTTTGTGATAAATGAAC ggttt
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page