yeaH Gene Page

Genbank name: yeaH
EcoGene name: yeaH
Divergent gene:
Species with an ortholog: EC PA SP ST TF VC YP
EcoGene link: EG13494

Species that contributed to the solution: EC SP ST TF VC
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 9.54
Model logo: yeaH.1.model.LGO.gif
Sequence logo: yeaH.1.LGO.gif
Sequence Alignment: yeaH.1.ALGN
Solution location in genomic coordinates: 1866956-1866976
Solution sequence with flanking nucleotides: cagtt GGCAAATGTAGTACGGGGGGC at
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC SP ST VC YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 6.26
Model logo: yeaH.2.model.LGO.gif
Sequence logo: yeaH.2.LGO.gif
Sequence Alignment: yeaH.2.ALGN
Solution location in genomic coordinates: 1866897-1866920
Solution sequence with flanking nucleotides: ccggg CCTACAACGACAGCGAACCGTGGG cctga
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: REP134 Overlap: 5

Species that contributed to the solution: EC PA TF
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 5.74
Model logo: yeaH.3.model.LGO.gif
Sequence logo: yeaH.3.LGO.gif
Sequence Alignment: yeaH.3.ALGN
Solution location in genomic coordinates: 1866921-1866941
Solution sequence with flanking nucleotides: gtggg CCTGAGAAGCGGCAACACAGG cgtag
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: REP134 Overlap: 21

Gene Index Page