yeaQ Gene Page
Genbank name: yeaQ
EcoGene name: yeaQ
Divergent gene:
Species with an ortholog:
EC ST YP
EcoGene link: EG13503
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 6.51
Model logo: yeaQ.1.model.LGO.gif
Sequence logo: yeaQ.1.LGO.gif
Sequence Alignment: yeaQ.1.ALGN
Solution location in genomic coordinates: 1877308-1877331 R
Solution sequence with flanking nucleotides: gctat GCTTTTTATCAGCGACTAACCCGC taatg
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 6.08
Model logo: yeaQ.2.model.LGO.gif
Sequence logo: yeaQ.2.LGO.gif
Sequence Alignment: yeaQ.2.ALGN
Solution location in genomic coordinates: 1877351-1877373 R
Solution sequence with flanking nucleotides: cctcc GTGATGCTCGTCACAAATCTTGC cctcc
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 4.93
Model logo: yeaQ.3.model.LGO.gif
Sequence logo: yeaQ.3.LGO.gif
Sequence Alignment: yeaQ.3.ALGN
Solution location in genomic coordinates: 1877382-1877401 R
Solution sequence with flanking nucleotides: cgcaa TTTCTGCGCCATCGCAAAAA aaacc
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page