yeaV Gene Page
Genbank name: yeaV
EcoGene name: yeaV
Divergent gene:
Species with an ortholog:
EC YP
EcoGene link: EG13508
Species that contributed to the solution: EC YP
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 5.77
Model logo: yeaV.1.model.LGO.gif
Sequence logo: yeaV.1.LGO.gif
Sequence Alignment: yeaV.1.ALGN
Solution location in genomic coordinates: 1881150-1881169
Solution sequence with flanking nucleotides: cttaa TTGTTTAATTTATGTAACAT gcaaa
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC
Total number of sites in the solution: 1
Number of E. coli sites in the solution: 1
Map value: 2.56
Model logo: yeaV.2.model.LGO.gif
Sequence logo:
Sequence Alignment: yeaV.2.ALGN
Solution location in genomic coordinates: 1881043-1881059
Solution sequence with flanking nucleotides: ttgaa CCGCGTCACTGACGCGG ttttt
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: yeaU_yeaV_IR     Overlap: 17
Species that contributed to the solution: EC YP
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 1.28
Model logo: yeaV.3.model.LGO.gif
Sequence logo: yeaV.3.LGO.gif
Sequence Alignment: yeaV.3.ALGN
Solution location in genomic coordinates: 1881083-1881100
Solution sequence with flanking nucleotides: gcagt AAATAACCTGCGTCATTT cacct
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page