yedL Gene Page

Genbank name: yedL
EcoGene name: yedL
Divergent gene:
Species with an ortholog: EC   SP   
EcoGene link: EG13279

Species that contributed to the solution: EC SP
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 6.65
Model logo: yedL.1.model.LGO.gif
Sequence logo: yedL.1.LGO.gif
Sequence Alignment: yedL.1.ALGN
Solution location in genomic coordinates: 2008522-2008539
Solution sequence with flanking nucleotides: ctgga GATTATTGATCAACAATA ctgcg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC SP
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: -1.15
Model logo: yedL.2.model.LGO.gif
Sequence logo: yedL.2.LGO.gif
Sequence Alignment: yedL.2.ALGN
Solution location in genomic coordinates: 2008553-2008573
Solution sequence with flanking nucleotides: taaga AATCTCTATTAGACAAAGATT tcatt
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page