yejL Gene Page

Genbank name: yejL
EcoGene name: yejL
Divergent gene: yejK
Species with an ortholog: EC   ST   YP   
EcoGene link: EG12043

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 13.95
Model logo: yejL.1.model.LGO.gif
Sequence logo: yejL.1.LGO.gif
Sequence Alignment: yejL.1.ALGN
Solution location in genomic coordinates: 2282106-2282123
Solution sequence with flanking nucleotides: ttgct ACGGTAATATGTTGCCCT ttcat
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 12.01
Model logo: yejL.2.model.LGO.gif
Sequence logo: yejL.2.LGO.gif
Sequence Alignment: yejL.2.ALGN
Solution location in genomic coordinates: 2281982-2281999
Solution sequence with flanking nucleotides: tcctt TAAGACCGGGCGGTATTC aacca
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 9.08
Model logo: yejL.3.model.LGO.gif
Sequence logo: yejL.3.LGO.gif
Sequence Alignment: yejL.3.ALGN
Solution location in genomic coordinates: 2282082-2282105
Solution sequence with flanking nucleotides: cataa AAAAGCAGAAAAAAAACCGTTGCT acggt
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page