yfhL Gene Page

Genbank name: yfhL
EcoGene name: yfhL
Divergent gene:
Species with an ortholog: EC HI PA SP ST TF VC YP
EcoGene link: EG13215

Species that contributed to the solution: EC SP ST VC
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 11.99
Model logo: yfhL.1.model.LGO.gif
Sequence logo: yfhL.1.LGO.gif
Sequence Alignment: yfhL.1.ALGN
Solution location in genomic coordinates: 2697637-2697653
Solution sequence with flanking nucleotides: agaat GCGCGTATAATGCCCGC ccggt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI PA SP ST TF YP
Total number of sites in the solution: 9
Number of E. coli sites in the solution: 1
Map value: 0.48
Model logo: yfhL.2.model.LGO.gif
Sequence logo: yfhL.2.LGO.gif
Sequence Alignment: yfhL.2.ALGN
Solution location in genomic coordinates: 2697659-2697680
Solution sequence with flanking nucleotides: ccggt TTGTGTTGTTTTGAGAGTTTCC tt
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page