ygdP Gene Page
Genbank name: ygdP
EcoGene name: ygdP
Divergent gene: mutH
Species with an ortholog:
AA EC HI PA SP ST TF VC YP
EcoGene link: EG13091
Species that contributed to the solution: EC HI SP ST VC YP
Total number of sites in the solution: 9
Number of E. coli sites in the solution: 2
Map value: 52.36
Model logo: ygdP.1.model.LGO.gif
Sequence logo: ygdP.1.LGO.gif
Sequence Alignment: ygdP.1.ALGN
Solution location in genomic coordinates: 2967473-2967495 R
Solution sequence with flanking nucleotides: catg TTATCCACAGAAAGCTGGGATAA ctgtg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2967157-2967179 R
Solution sequence with flanking nucleotides: caact CTATCCACAGAAAAGGTGAATAA aaacg
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: AA EC HI PA SP ST YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 1
Map value: 24.34
Model logo: ygdP.2.model.LGO.gif
Sequence logo: ygdP.2.LGO.gif
Sequence Alignment: ygdP.2.ALGN
Solution location in genomic coordinates: 2967033-2967049 R
Solution sequence with flanking nucleotides: ttcct GGAGTATGAAACAATCA ttcgt
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: AA EC ST VC YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 2
Map value: 17.76
Model logo: ygdP.3.model.LGO.gif
Sequence logo: ygdP.3.LGO.gif
Sequence Alignment: ygdP.3.ALGN
Solution location in genomic coordinates: 2967434-2967454 R
Solution sequence with flanking nucleotides: ccact ACTGTTTCCATTTACAGCCTT gacgt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2967340-2967360 R
Solution sequence with flanking nucleotides: acggc ATTGGTTGATCTTTCGCCAAC ccgta
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page