ygfY Gene Page

Genbank name: ygfY
EcoGene name: ygfY
Divergent gene: ygfZ
Species with an ortholog: EC ST YP
EcoGene link: EG13075

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 13.87
Model logo: ygfY.1.model.LGO.gif
Sequence logo: ygfY.1.LGO.gif
Sequence Alignment: ygfY.1.ALGN
Solution location in genomic coordinates: 3039110-3039133 R
Solution sequence with flanking nucleotides: aacac GTTACAATAGCCGGGTACTGGATT ttcgt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 10.19
Model logo: ygfY.2.model.LGO.gif
Sequence logo: ygfY.2.LGO.gif
Sequence Alignment: ygfY.2.ALGN
Solution location in genomic coordinates: 3039151-3039168 R
Solution sequence with flanking nucleotides: ggtgt TTACTGATATTCCCGTAA aagaa
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 7.98
Model logo: ygfY.3.model.LGO.gif
Sequence logo: ygfY.3.LGO.gif
Sequence Alignment: ygfY.3.ALGN
Solution location in genomic coordinates: 3039255-3039276 R
Solution sequence with flanking nucleotides: ctatg AGGCAATGCAAGTGCTTTCACT acgcg
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page