ygfZ Gene Page
Genbank name: ygfZ
EcoGene name: ygfZ
Divergent gene: ygfY
Species with an ortholog:
EC SP ST VC YP
EcoGene link: EG12685
Species that contributed to the solution: EC SP ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 13.37
Model logo: ygfZ.1.model.LGO.gif
Sequence logo: ygfZ.1.LGO.gif
Sequence Alignment: ygfZ.1.ALGN
Solution location in genomic coordinates: 3039110-3039133
Solution sequence with flanking nucleotides: acgaa AATCCAGTACCCGGCTATTGTAAC gtgtt
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC SP ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 10.19
Model logo: ygfZ.2.model.LGO.gif
Sequence logo: ygfZ.2.LGO.gif
Sequence Alignment: ygfZ.2.ALGN
Solution location in genomic coordinates: 3039254-3039273
Solution sequence with flanking nucleotides: tcgcg TAGTGAAAGCACTTGCATTG cctca
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC SP ST YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 2
Map value: 8.49
Model logo: ygfZ.3.model.LGO.gif
Sequence logo: ygfZ.3.LGO.gif
Sequence Alignment: ygfZ.3.ALGN
Solution location in genomic coordinates: 3039194-3039216
Solution sequence with flanking nucleotides: ttaat TCACAACAATTCAATGGCTTCAT ttttt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3039257-3039279
Solution sequence with flanking nucleotides: cgtag TGAAAGCACTTGCATTGCCTCAT agctc
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page