ygjI Gene Page

Genbank name: ygjI
EcoGene name: ygjI
Divergent gene:
Species with an ortholog: EC ST
EcoGene link: EG12720

Species that contributed to the solution: EC
Total number of sites in the solution: 1
Number of E. coli sites in the solution: 1
Map value: 1.00
Model logo: ygjI.1.model.LGO.gif
Sequence logo:
Sequence Alignment: ygjI.1.ALGN
Solution location in genomic coordinates: 3223820-3223842
Solution sequence with flanking nucleotides: actac GGCGGCAAAAGGAGTTTGCCGCC accgc
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page