ygjT Gene Page

Genbank name: ygjT
EcoGene name: ygjT
Divergent gene:
Species with an ortholog: EC PA SP ST VC YP
EcoGene link: EG12731

Species that contributed to the solution: EC ST VC
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 17.38
Model logo: ygjT.1.model.LGO.gif
Sequence logo: ygjT.1.LGO.gif
Sequence Alignment: ygjT.1.ALGN
Solution location in genomic coordinates: 3236094-3236117
Solution sequence with flanking nucleotides: cccga AAGGAATACGCAGACGTATTCCTT ttttg
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: ygjR_ygjT_IR Overlap: 24

Species that contributed to the solution: EC ST VC
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 17.27
Model logo: ygjT.2.model.LGO.gif
Sequence logo: ygjT.2.LGO.gif
Sequence Alignment: ygjT.2.ALGN
Solution location in genomic coordinates: 3236132-3236155
Solution sequence with flanking nucleotides: aagtg AGACCTTGCCGGAAGGCGAGGTCT atgca
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 15.19
Model logo: ygjT.3.model.LGO.gif
Sequence logo: ygjT.3.LGO.gif
Sequence Alignment: ygjT.3.ALGN
Solution location in genomic coordinates: 3236005-3236028
Solution sequence with flanking nucleotides: catac TTTGTTACCTGCAAAGGGGAGTAA cttca
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3236031-3236054
Solution sequence with flanking nucleotides: taact TCATTGCCGGTCGATCGTCATTAC gatgt
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page