yhbC Gene Page

Genbank name: yhbC
EcoGene name: yhbC
Divergent gene:
Species with an ortholog: EC   HI   PA   SP   ST   TF   VC   YP   
EcoGene link: EG11179

Species that contributed to the solution: EC HI PA SP ST VC YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 1
Map value: 51.37
Model logo: yhbC.1.model.LGO.gif
Sequence logo: yhbC.1.LGO.gif
Sequence Alignment: yhbC.1.ALGN
Solution location in genomic coordinates: 3315710-3315732 R
Solution sequence with flanking nucleotides: tatat AAAGCCCCGATTTATCGGGGTTT tttgt
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: yhbC_metY_IR1     Overlap: 23

Species that contributed to the solution: EC HI PA SP ST TF VC YP
Total number of sites in the solution: 13
Number of E. coli sites in the solution: 2
Map value: 47.28
Model logo: yhbC.2.model.LGO.gif
Sequence logo: yhbC.2.LGO.gif
Sequence Alignment: yhbC.2.ALGN
Solution location in genomic coordinates: 3315710-3315732 R
Solution sequence with flanking nucleotides: tatat AAAGCCCCGATTTATCGGGGTTT tttgt
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: yhbC_metY_IR1     Overlap: 23
Solution location in genomic coordinates: 3315667-3315689 R
Solution sequence with flanking nucleotides: cagaa TAACTGGGCTTTAGGCCCTTTTT ttatg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI ST YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 26.45
Model logo: yhbC.3.model.LGO.gif
Sequence logo: yhbC.3.LGO.gif
Sequence Alignment: yhbC.3.ALGN
Solution location in genomic coordinates: 3315829-3315852 R
Solution sequence with flanking nucleotides: c TTTCCCTTAGAGTCCTTTTTCAAA tatac
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: yhbC_metY_IR2     Overlap: 24
Solution location in genomic coordinates: 3315774-3315797 R
Solution sequence with flanking nucleotides: agtgg GATTTGAAAAAATCCTTCTGGAAA gtgct
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: yhbC_metY_IR2     Overlap: 24


Gene Index Page