yhcC Gene Page
Genbank name: yhcC
EcoGene name: yhcC
Divergent gene: gltB
Species with an ortholog:
EC SP ST VC YP
EcoGene link: EG12809
Species that contributed to the solution: EC SP ST VC YP
Total number of sites in the solution: 9
Number of E. coli sites in the solution: 2
Map value: 19.75
Model logo: yhcC.1.model.LGO.gif
Sequence logo: yhcC.1.LGO.gif
Sequence Alignment: yhcC.1.ALGN
Solution location in genomic coordinates: 3352043-3352064 R
Solution sequence with flanking nucleotides: ttctt TATTAAATGACTGAAATTAAAA tggat
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3351775-3351796 R
Solution sequence with flanking nucleotides: ttttg ATTGATTATGCAGTTGATAAAA gcagg
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC SP ST
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 14.53
Model logo: yhcC.2.model.LGO.gif
Sequence logo: yhcC.2.LGO.gif
Sequence Alignment: yhcC.2.ALGN
Solution location in genomic coordinates: 3351810-3351832 R
Solution sequence with flanking nucleotides: aagtg ATTTATGTGATTATGCATGAAAT ttcgg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3351779-3351801 R
Solution sequence with flanking nucleotides: ggtaa TTTTGATTGATTATGCAGTTGAT aaaag
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 12.53
Model logo: yhcC.3.model.LGO.gif
Sequence logo: yhcC.3.LGO.gif
Sequence Alignment: yhcC.3.ALGN
Solution location in genomic coordinates: 3351699-3351715 R
Solution sequence with flanking nucleotides: ctttg GCCTCTTTTCAAGGCGC ggtct
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page