yhcJ Gene Page

Genbank name: yhcJ
EcoGene name: nanE
Divergent gene:
Species with an ortholog: EC   HI   ST   VC   YP   
EcoGene link: EG12816

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 6.07
Model logo: yhcJ.1.model.LGO.gif
Sequence logo: yhcJ.1.LGO.gif
Sequence Alignment: yhcJ.1.ALGN
Solution location in genomic coordinates: 3368690-3368713 R
Solution sequence with flanking nucleotides: tcctg TTGCCCGGTCTATGTACCGGGCCT ttcgc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 0.59
Model logo: yhcJ.2.model.LGO.gif
Sequence logo: yhcJ.2.LGO.gif
Sequence Alignment: yhcJ.2.ALGN
Solution location in genomic coordinates: 3368674-3368689 R
Solution sequence with flanking nucleotides: ggcct TTCGCTAAGGGAAGAT gt
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page