yheR Gene Page

Genbank name: yheR
EcoGene name: yheR
Divergent gene: yheS
Species with an ortholog: EC ST VC YP
EcoGene link: EG12902

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 17.08
Model logo: yheR.1.model.LGO.gif
Sequence logo: yheR.1.LGO.gif
Sequence Alignment: yheR.1.ALGN
Solution location in genomic coordinates: 3478878-3478900 R
Solution sequence with flanking nucleotides: tatgt TAACTTATCATTATGATAATGTA atgta
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 5.38
Model logo: yheR.2.model.LGO.gif
Sequence logo: yheR.2.LGO.gif
Sequence Alignment: yheR.2.ALGN
Solution location in genomic coordinates: 3478902-3478918 R
Solution sequence with flanking nucleotides: ggtgc CGTATGTTCAGACTATG ttaac
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 5.08
Model logo: yheR.3.model.LGO.gif
Sequence logo: yheR.3.LGO.gif
Sequence Alignment: yheR.3.ALGN
Solution location in genomic coordinates: 3478824-3478847 R
Solution sequence with flanking nucleotides: gcgca ATGGTAGCCCAAAACAGCGACTAT acaca
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page