yheS Gene Page

Genbank name: yheS
EcoGene name: yheS
Divergent gene: yheR
Species with an ortholog: AA   EC   HI   PA   SP   ST   TF   VC   YP   
EcoGene link: EG12903

Species that contributed to the solution: EC HI SP ST YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 18.73
Model logo: yheS.1.model.LGO.gif
Sequence logo: yheS.1.LGO.gif
Sequence Alignment: yheS.1.ALGN
Solution location in genomic coordinates: 3478869-3478888
Solution sequence with flanking nucleotides: gctcg CCCATACATTACATTATCAT aatga
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3478890-3478909
Solution sequence with flanking nucleotides: tcata ATGATAAGTTAACATAGTCT gaaca
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 14.35
Model logo: yheS.2.model.LGO.gif
Sequence logo: yheS.2.LGO.gif
Sequence Alignment: yheS.2.ALGN
Solution location in genomic coordinates: 3478878-3478900
Solution sequence with flanking nucleotides: tacat TACATTATCATAATGATAAGTTA acata
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI SP ST TF VC YP
Total number of sites in the solution: 9
Number of E. coli sites in the solution: 2
Map value: 9.39
Model logo: yheS.3.model.LGO.gif
Sequence logo: yheS.3.LGO.gif
Sequence Alignment: yheS.3.ALGN
Solution location in genomic coordinates: 3478880-3478898
Solution sequence with flanking nucleotides: catta CATTATCATAATGATAAGT taaca
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3478901-3478919
Solution sequence with flanking nucleotides: agtta ACATAGTCTGAACATACGG cacct
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page