yhgH Gene Page

Genbank name: yhgH
EcoGene name: yhgH
Divergent gene: bioH
Species with an ortholog: EC   PA   SP   ST   YP   
EcoGene link: EG12934

Species that contributed to the solution: EC PA SP ST
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 2
Map value: 14.64
Model logo: yhgH.1.model.LGO.gif
Sequence logo: yhgH.1.LGO.gif
Sequence Alignment: yhgH.1.ALGN
Solution location in genomic coordinates: 3542004-3542023
Solution sequence with flanking nucleotides: aacgc CCGCGCATCCTGGCGCGCCG tttca
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3542215-3542234
Solution sequence with flanking nucleotides: tctgg CTTGCCACCAGCCCGCCCAG actcc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC SP ST
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 13.65
Model logo: yhgH.2.model.LGO.gif
Sequence logo: yhgH.2.LGO.gif
Sequence Alignment: yhgH.2.ALGN
Solution location in genomic coordinates: 3542049-3542072
Solution sequence with flanking nucleotides: aacgc CAGGAACCGCTCCACTGTACGCTG aaaat
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3542427-3542450
Solution sequence with flanking nucleotides: tgcag CAGCACAAGATGAACATTCCCCTG acctt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 8.97
Model logo: yhgH.3.model.LGO.gif
Sequence logo: yhgH.3.LGO.gif
Sequence Alignment: yhgH.3.ALGN
Solution location in genomic coordinates: 3542266-3542281
Solution sequence with flanking nucleotides: caggt GCCTGTTGCAGCACGG cttcg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3542419-3542434
Solution sequence with flanking nucleotides: cccat CCGTGCAGCAGCACAA gatga
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page