yhjK Gene Page

Genbank name: yhjK
EcoGene name: yhjK
Divergent gene:
Species with an ortholog: EC   PA   SP   ST   YP   
EcoGene link: EG12256

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 19.22
Model logo: yhjK.1.model.LGO.gif
Sequence logo: yhjK.1.LGO.gif
Sequence Alignment: yhjK.1.ALGN
Solution location in genomic coordinates: 3683277-3683297 R
Solution sequence with flanking nucleotides: cgctg CGATCGGGTATACTCGGGCGG caatc
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3683256-3683276 R
Solution sequence with flanking nucleotides: ggcgg CAATCTGGGATTTCCGGGGGG agaca
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 15.46
Model logo: yhjK.2.model.LGO.gif
Sequence logo: yhjK.2.LGO.gif
Sequence Alignment: yhjK.2.ALGN
Solution location in genomic coordinates: 3683216-3683234 R
Solution sequence with flanking nucleotides: agtcg CTCGTTAACAATCAAGCAG
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 11.06
Model logo: yhjK.3.model.LGO.gif
Sequence logo: yhjK.3.LGO.gif
Sequence Alignment: yhjK.3.ALGN
Solution location in genomic coordinates: 3683306-3683326 R
Solution sequence with flanking nucleotides: aagtt TTCAGATAGCGCCTCTCTTAA tgccg
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page