yiaI Gene Page
Genbank name: yiaI
EcoGene name: ysaA
Divergent gene:
Species with an ortholog:
EC ST
EcoGene link: EG14319
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 5.49
Model logo: yiaI.1.model.LGO.gif
Sequence logo: yiaI.1.LGO.gif
Sequence Alignment: yiaI.1.ALGN
Solution location in genomic coordinates: 3739248-3739271 R
Solution sequence with flanking nucleotides: cgttg GATCAAAGCAGTAGGGACGCGCTC tctgg
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 4.92
Model logo: yiaI.2.model.LGO.gif
Sequence logo: yiaI.2.LGO.gif
Sequence Alignment: yiaI.2.ALGN
Solution location in genomic coordinates: 3739261-3739282 R
Solution sequence with flanking nucleotides: aacat TTCCTTCGTTGGATCAAAGCAG taggg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3739217-3739238 R
Solution sequence with flanking nucleotides: gcact CTGCTGTTTTAGTGCAAAGGAG tgatc
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 3.80
Model logo: yiaI.3.model.LGO.gif
Sequence logo: yiaI.3.LGO.gif
Sequence Alignment: yiaI.3.ALGN
Solution location in genomic coordinates: 3739292-3739309 R
Solution sequence with flanking nucleotides: aacgc TTTGGACAAGTGCCAAAA cttta
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page