yiaJ Gene Page

Genbank name: yiaJ
EcoGene name: yiaJ
Divergent gene: yiaK
Species with an ortholog: EC   HI   ST   
EcoGene link: EG12278

Species that contributed to the solution: EC HI ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 14.53
Model logo: yiaJ.1.model.LGO.gif
Sequence logo: yiaJ.1.LGO.gif
Sequence Alignment: yiaJ.1.ALGN
Solution location in genomic coordinates: 3740304-3740320 R
Solution sequence with flanking nucleotides: ttaaa ATTTCAATATGCGAAAC ttgat
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 8.34
Model logo: yiaJ.2.model.LGO.gif
Sequence logo: yiaJ.2.LGO.gif
Sequence Alignment: yiaJ.2.ALGN
Solution location in genomic coordinates: 3740278-3740299 R
Solution sequence with flanking nucleotides: cttga TTTCAAATATATCGATCACTTT ttaac
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3740220-3740241 R
Solution sequence with flanking nucleotides: aagac ATAAAAATCAATTGGTTATAAA ttatc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 7.03
Model logo: yiaJ.3.model.LGO.gif
Sequence logo: yiaJ.3.LGO.gif
Sequence Alignment: yiaJ.3.ALGN
Solution location in genomic coordinates: 3740186-3740209 R
Solution sequence with flanking nucleotides: tgtcg AGATCGTGAACTACGGCACACTTT gcgct
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page