yibF Gene Page
Genbank name: yibF
EcoGene name: yibF
Divergent gene: rhsA
Species with an ortholog:
EC ST TF
EcoGene link: EG11762
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 1.74
Model logo: yibF.1.model.LGO.gif
Sequence logo: yibF.1.LGO.gif
Sequence Alignment: yibF.1.ALGN
Solution location in genomic coordinates: 3759667-3759687 R
Solution sequence with flanking nucleotides: cacca TGATAAATATGTGATTTATTT ggaag
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 1.71
Model logo: yibF.2.model.LGO.gif
Sequence logo: yibF.2.LGO.gif
Sequence Alignment: yibF.2.ALGN
Solution location in genomic coordinates: 3759722-3759737 R
Solution sequence with flanking nucleotides: cctga AGTGAGATATCCATCA gagtg
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: -0.00
Model logo: yibF.3.model.LGO.gif
Sequence logo: yibF.3.LGO.gif
Sequence Alignment: yibF.3.ALGN
Solution location in genomic coordinates: 3759694-3759715 R
Solution sequence with flanking nucleotides: agtga AATAATTAGGAAAATATTTATA tcacc
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3759668-3759689 R
Solution sequence with flanking nucleotides: atcac CATGATAAATATGTGATTTATT tggaa
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page