yicG Gene Page

Genbank name: yicG
EcoGene name: yicG
Divergent gene:
Species with an ortholog: AA EC HI PA SP ST VC YP
EcoGene link: EG11683

Species that contributed to the solution: EC SP ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 17.75
Model logo: yicG.1.model.LGO.gif
Sequence logo: yicG.1.LGO.gif
Sequence Alignment: yicG.1.ALGN
Solution location in genomic coordinates: 3816429-3816445
Solution sequence with flanking nucleotides: cctcc CCTTAAAAAATCTCAAT c
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC HI SP ST VC YP
Total number of sites in the solution: 11
Number of E. coli sites in the solution: 1
Map value: 14.30
Model logo: yicG.2.model.LGO.gif
Sequence logo: yicG.2.LGO.gif
Sequence Alignment: yicG.2.ALGN
Solution location in genomic coordinates: 3816333-3816355
Solution sequence with flanking nucleotides: atttt TTCTTATGCATTTTCTCAGACAA gaagt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC SP ST VC YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 1
Map value: 12.37
Model logo: yicG.3.model.LGO.gif
Sequence logo: yicG.3.LGO.gif
Sequence Alignment: yicG.3.ALGN
Solution location in genomic coordinates: 3816389-3816410
Solution sequence with flanking nucleotides: gaaaa TAGCGATTTCACATAACTACAA gttat
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page