yidE Gene Page
Genbank name: yidE
EcoGene name: yidE
Divergent gene:
Species with an ortholog:
EC HI ST VC YP
EcoGene link: EG11536
Species that contributed to the solution: EC HI ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 8.84
Model logo: yidE.1.model.LGO.gif
Sequence logo: yidE.1.LGO.gif
Sequence Alignment: yidE.1.ALGN
Solution location in genomic coordinates: 3864011-3864030 R
Solution sequence with flanking nucleotides: atgcg TTAAATTTCGACTGTTTAAG atatt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3863925-3863944 R
Solution sequence with flanking nucleotides: tcagc CATAATCCGTAGCAATTAAA
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 6.50
Model logo: yidE.2.model.LGO.gif
Sequence logo: yidE.2.LGO.gif
Sequence Alignment: yidE.2.ALGN
Solution location in genomic coordinates: 3863952-3863975 R
Solution sequence with flanking nucleotides: gtgcg CTATAAGGCAAATCTGCTTCACCG attca
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC HI ST VC
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 5.99
Model logo: yidE.3.model.LGO.gif
Sequence logo: yidE.3.LGO.gif
Sequence Alignment: yidE.3.ALGN
Solution location in genomic coordinates: 3863978-3864001 R
Solution sequence with flanking nucleotides: ttcgg CACGTTCTTTCCCGTGATAATGTG cgcta
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page