yieG Gene Page
Genbank name: yieG
EcoGene name: yieG
Divergent gene: yieH
Species with an ortholog:
EC ST YP
EcoGene link: EG11724
Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 13.49
Model logo: yieG.1.model.LGO.gif
Sequence logo: yieG.1.LGO.gif
Sequence Alignment: yieG.1.ALGN
Solution location in genomic coordinates: 3894370-3894385 R
Solution sequence with flanking nucleotides: taatc AGTTTAACGTTTTCGT agagc
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3894338-3894353 R
Solution sequence with flanking nucleotides: gcgca ACGCAATCGTTGCCGT ataag
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 12.05
Model logo: yieG.2.model.LGO.gif
Sequence logo: yieG.2.LGO.gif
Sequence Alignment: yieG.2.ALGN
Solution location in genomic coordinates: 3894286-3894307 R
Solution sequence with flanking nucleotides: ctcac AAACGCGCCTATTGTCGCATTT tggta
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 11.96
Model logo: yieG.3.model.LGO.gif
Sequence logo: yieG.3.LGO.gif
Sequence Alignment: yieG.3.ALGN
Solution location in genomic coordinates: 3894322-3894343 R
Solution sequence with flanking nucleotides: atcgt TGCCGTATAAGTAAATCCAATA aaaaa
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3894274-3894295 R
Solution sequence with flanking nucleotides: cctat TGTCGCATTTTGGTATACGATA gcgac
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page