yieH Gene Page

Genbank name: yieH
EcoGene name: yieH
Divergent gene: yieG
Species with an ortholog: EC   ST   VC   YP   
EcoGene link: EG11725

Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 13.26
Model logo: yieH.1.model.LGO.gif
Sequence logo: yieH.1.LGO.gif
Sequence Alignment: yieH.1.ALGN
Solution location in genomic coordinates: 3894337-3894354
Solution sequence with flanking nucleotides: actta TACGGCAACGATTGCGTT gcgca
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3894369-3894386
Solution sequence with flanking nucleotides: ggctc TACGAAAACGTTAAACTG attaa
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 12.18
Model logo: yieH.2.model.LGO.gif
Sequence logo: yieH.2.LGO.gif
Sequence Alignment: yieH.2.ALGN
Solution location in genomic coordinates: 3894286-3894307
Solution sequence with flanking nucleotides: tacca AAATGCGACAATAGGCGCGTTT gtgag
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST VC
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 9.81
Model logo: yieH.3.model.LGO.gif
Sequence logo: yieH.3.LGO.gif
Sequence Alignment: yieH.3.ALGN
Solution location in genomic coordinates: 3894313-3894336
Solution sequence with flanking nucleotides: gtgag AGACTTTTTTATTGGATTTACTTA tacgg
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page