yigL Gene Page

Genbank name: yigL
EcoGene name: yigL
Divergent gene:
Species with an ortholog: AA   EC   HI   ST   VC   YP   
EcoGene link: EG11470

Species that contributed to the solution: AA EC HI ST VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 34.64
Model logo: yigL.1.model.LGO.gif
Sequence logo: yigL.1.LGO.gif
Sequence Alignment: yigL.1.ALGN
Solution location in genomic coordinates: 4007818-4007840
Solution sequence with flanking nucleotides: aggtt GTTGCGTCTGATTTAGATGGCAC gttac
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC HI ST VC YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 2
Map value: 19.19
Model logo: yigL.2.model.LGO.gif
Sequence logo: yigL.2.LGO.gif
Sequence Alignment: yigL.2.ALGN
Solution location in genomic coordinates: 4007797-4007817
Solution sequence with flanking nucleotides: t AAATTTCTTATGTACCAGGTT gttgc
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 4007878-4007898
Solution sequence with flanking nucleotides: acgcc AAAGAAACTCTGAAGCTGCTC accgc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 13.49
Model logo: yigL.3.model.LGO.gif
Sequence logo: yigL.3.LGO.gif
Sequence Alignment: yigL.3.ALGN
Solution location in genomic coordinates: 4007858-4007874
Solution sequence with flanking nucleotides: cgacc ATACGTTATCCCCTTAC gccaa
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page