yihE Gene Page

Genbank name: yihE
EcoGene name: yihE
Divergent gene:
Species with an ortholog: EC PA SP ST VC YP
EcoGene link: EG11831 Reported site,genomic coordinates and site type: DPInteract 4039915:4039929 cpxR

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 11.80
Model logo: yihE.1.model.LGO.gif
Sequence logo: yihE.1.LGO.gif
Sequence Alignment: yihE.1.ALGN
Solution location in genomic coordinates: 4039968-4039991
Solution sequence with flanking nucleotides: cttcg TCATTCGTAATGTTTTCCGGATGA tggg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC PA SP ST VC
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 9.57
Model logo: yihE.2.model.LGO.gif
Sequence logo: yihE.2.LGO.gif
Sequence Alignment: yihE.2.ALGN
Solution location in genomic coordinates: 4039943-4039958
Solution sequence with flanking nucleotides: ccaaa ATCATCGTGAAATGAT aatcc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC SP ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 7.32
Model logo: yihE.3.model.LGO.gif
Sequence logo: yihE.3.LGO.gif
Sequence Alignment: yihE.3.ALGN
Solution location in genomic coordinates: 4039923-4039941
Solution sequence with flanking nucleotides: aaagc TTGTAAGCGGCGCCACCAA aatca
Number of overlapping basepairs with reported site: 7
Site type: cpxR

Gene Index Page