yjcB Gene Page
Genbank name: yjcB
EcoGene name: yjcB
Divergent gene: yjcC
Species with an ortholog:
EC ST
EcoGene link: EG11937
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 13.33
Model logo: yjcB.1.model.LGO.gif
Sequence logo: yjcB.1.LGO.gif
Sequence Alignment: yjcB.1.ALGN
Solution location in genomic coordinates: 4272750-4272767 R
Solution sequence with flanking nucleotides: atcaa TTGTGATATAGTTCACAA aatta
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: yjcB_yjcC_IR Overlap: 5
Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 8.15
Model logo: yjcB.2.model.LGO.gif
Sequence logo: yjcB.2.LGO.gif
Sequence Alignment: yjcB.2.ALGN
Solution location in genomic coordinates: 4272882-4272904 R
Solution sequence with flanking nucleotides: gaaaa TAATTCATTGATATTCAAAATTA atttc
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 4272737-4272759 R
Solution sequence with flanking nucleotides: tgata TAGTTCACAAAATTAATGAAACA aacag
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: yjcB_yjcC_IR Overlap: 18
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 0.55
Model logo: yjcB.3.model.LGO.gif
Sequence logo: yjcB.3.LGO.gif
Sequence Alignment: yjcB.3.ALGN
Solution location in genomic coordinates: 4272785-4272805 R
Solution sequence with flanking nucleotides: cagca ATAAAAGTCACGGCCTAATAT ggcta
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page