yjcC Gene Page

Genbank name: yjcC
EcoGene name: yjcC
Divergent gene: yjcB
Species with an ortholog: EC   ST   
EcoGene link: EG11938

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 11.27
Model logo: yjcC.1.model.LGO.gif
Sequence logo: yjcC.1.LGO.gif
Sequence Alignment: yjcC.1.ALGN
Solution location in genomic coordinates: 4272750-4272767
Solution sequence with flanking nucleotides: taatt TTGTGAACTATATCACAA ttgat
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: yjcB_yjcC_IR     Overlap: 5

Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 8.01
Model logo: yjcC.2.model.LGO.gif
Sequence logo: yjcC.2.LGO.gif
Sequence Alignment: yjcC.2.ALGN
Solution location in genomic coordinates: 4272737-4272759
Solution sequence with flanking nucleotides: ctgtt TGTTTCATTAATTTTGTGAACTA tatca
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: yjcB_yjcC_IR     Overlap: 18
Solution location in genomic coordinates: 4272882-4272904
Solution sequence with flanking nucleotides: gaaat TAATTTTGAATATCAATGAATTA ttttc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 1.97
Model logo: yjcC.3.model.LGO.gif
Sequence logo: yjcC.3.LGO.gif
Sequence Alignment: yjcC.3.ALGN
Solution location in genomic coordinates: 4272959-4272980
Solution sequence with flanking nucleotides: agtgc TATTTATACCGTAAGATTTATC taaag
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page