yjcW Gene Page

Genbank name: yjcW
EcoGene name: alsA
Divergent gene:
Species with an ortholog: EC   VC   YP   
EcoGene link: EG11959

Species that contributed to the solution: EC VC
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 2.01
Model logo: yjcW.1.model.LGO.gif
Sequence logo: yjcW.1.LGO.gif
Sequence Alignment: yjcW.1.ALGN
Solution location in genomic coordinates: 4308576-4308597 R
Solution sequence with flanking nucleotides: gccat CAGGCAATAATACGATATTTCG tgcag
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: REPv322a     Overlap: 5

Species that contributed to the solution: EC YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 0.86
Model logo: yjcW.2.model.LGO.gif
Sequence logo: yjcW.2.LGO.gif
Sequence Alignment: yjcW.2.ALGN
Solution location in genomic coordinates: 4308639-4308662 R
Solution sequence with flanking nucleotides: gatga TGCTAATGAAGTGTCTTATCCGGC caaca
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: REP322b     Overlap: 24
Solution location in genomic coordinates: 4308593-4308616 R
Solution sequence with flanking nucleotides: cgtag ACCTGATAAATGTAGCCATCAGGC aataa
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: REPv322a     Overlap: 24


Gene Index Page